This commit is contained in:
2024-11-28 17:05:14 +01:00
parent b034aad83f
commit 19b5b201b0
205 changed files with 0 additions and 2340 deletions
+58
View File
@@ -0,0 +1,58 @@
import csv
import sys
def main():
# TODO: Check for command-line usage
# TODO: Read database file into a variable
# TODO: Read DNA sequence file into a variable
# TODO: Find longest match of each STR in DNA sequence
# TODO: Check database for matching profiles
return
def longest_match(sequence, subsequence):
"""Returns length of longest run of subsequence in sequence."""
# Initialize variables
longest_run = 0
subsequence_length = len(subsequence)
sequence_length = len(sequence)
# Check each character in sequence for most consecutive runs of subsequence
for i in range(sequence_length):
# Initialize count of consecutive runs
count = 0
# Check for a subsequence match in a "substring" (a subset of characters) within sequence
# If a match, move substring to next potential match in sequence
# Continue moving substring and checking for matches until out of consecutive matches
while True:
# Adjust substring start and end
start = i + count * subsequence_length
end = start + subsequence_length
# If there is a match in the substring
if sequence[start:end] == subsequence:
count += 1
# If there is no match in the substring
else:
break
# Update most consecutive matches found
longest_run = max(longest_run, count)
# After checking for runs at each character in seqeuence, return longest run found
return longest_run
main()
+1
View File
@@ -0,0 +1 @@
AAGGTAAGTTTAGAATATAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGGAGATCAGATCAGATCAGATCTATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
+1
View File
@@ -0,0 +1 @@
CGCAAAGACTTTATTGCGCCCACAGTGGCTTTTGTCTACTGATTCCATAGATAATGACAAATGTTCAAGGGGTTCTGGTACTTAGTCCGATCTCAGTGCGACTCGGGGGCGAACGTCGTGGTTATAAACTCGTCCAGATGCCGGCGCCAAACAAATATGATCCCATTGTGCACCCCCACTGGTCAGAACTCTCGGTGCTTAAGCGATACACGCGTCCGTGAGCATTCAACACCCAACTACTAGTCCGGTAATCTGAATGCACACGTGGCCCGGGTTACCGGGATGCCGAAAGAAAGAAAG
File diff suppressed because one or more lines are too long
+1
View File
@@ -0,0 +1 @@
AGAAAGTGATGAGGGAGATAGTTAGGAAAAGGTTAAATTAAATTAAGAAAAATTATCTATCTATCTATCTATCAAGATAGGGAATAATGGAGAAATAAAGAAAGTGGAAAAAGATCAGATCAGATCTTTGGATTAATGGTGTAATAGTTTGGTGATAAAAGAGGTTAAAAAAGTATTAGAAATAAAAGATAAGGAAATGAATGAATGAGGAAGATTAGATTAATTGAATGTTAAAAGTTAA
+1
View File
@@ -0,0 +1 @@
GGGGAATATGGTTATTAAGTTAAAGAGAAAGAAAGATGTGGGTGATATTAATGAATGAATGAATGAATGAATGAATGAATGTTATGATAGAAGGATAAAAATTAAATAAAATTTTAGTTAATAGAAAAAGAATATATAGAGATCAGATCTATCTATCTATCTTAAGGAGAGGAAGAGATAAAAAAATATAATTAAGGAA
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long