Initial commit with cleaned history
This commit is contained in:
@@ -0,0 +1,58 @@
|
||||
import csv
|
||||
import sys
|
||||
|
||||
|
||||
def main():
|
||||
|
||||
# TODO: Check for command-line usage
|
||||
|
||||
# TODO: Read database file into a variable
|
||||
|
||||
# TODO: Read DNA sequence file into a variable
|
||||
|
||||
# TODO: Find longest match of each STR in DNA sequence
|
||||
|
||||
# TODO: Check database for matching profiles
|
||||
|
||||
return
|
||||
|
||||
|
||||
def longest_match(sequence, subsequence):
|
||||
"""Returns length of longest run of subsequence in sequence."""
|
||||
|
||||
# Initialize variables
|
||||
longest_run = 0
|
||||
subsequence_length = len(subsequence)
|
||||
sequence_length = len(sequence)
|
||||
|
||||
# Check each character in sequence for most consecutive runs of subsequence
|
||||
for i in range(sequence_length):
|
||||
|
||||
# Initialize count of consecutive runs
|
||||
count = 0
|
||||
|
||||
# Check for a subsequence match in a "substring" (a subset of characters) within sequence
|
||||
# If a match, move substring to next potential match in sequence
|
||||
# Continue moving substring and checking for matches until out of consecutive matches
|
||||
while True:
|
||||
|
||||
# Adjust substring start and end
|
||||
start = i + count * subsequence_length
|
||||
end = start + subsequence_length
|
||||
|
||||
# If there is a match in the substring
|
||||
if sequence[start:end] == subsequence:
|
||||
count += 1
|
||||
|
||||
# If there is no match in the substring
|
||||
else:
|
||||
break
|
||||
|
||||
# Update most consecutive matches found
|
||||
longest_run = max(longest_run, count)
|
||||
|
||||
# After checking for runs at each character in seqeuence, return longest run found
|
||||
return longest_run
|
||||
|
||||
|
||||
main()
|
||||
@@ -0,0 +1 @@
|
||||
AAGGTAAGTTTAGAATATAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGGAGATCAGATCAGATCAGATCTATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG
|
||||
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
@@ -0,0 +1 @@
|
||||
CGCAAAGACTTTATTGCGCCCACAGTGGCTTTTGTCTACTGATTCCATAGATAATGACAAATGTTCAAGGGGTTCTGGTACTTAGTCCGATCTCAGTGCGACTCGGGGGCGAACGTCGTGGTTATAAACTCGTCCAGATGCCGGCGCCAAACAAATATGATCCCATTGTGCACCCCCACTGGTCAGAACTCTCGGTGCTTAAGCGATACACGCGTCCGTGAGCATTCAACACCCAACTACTAGTCCGGTAATCTGAATGCACACGTGGCCCGGGTTACCGGGATGCCGAAAGAAAGAAAG
|
||||
File diff suppressed because one or more lines are too long
@@ -0,0 +1 @@
|
||||
AGAAAGTGATGAGGGAGATAGTTAGGAAAAGGTTAAATTAAATTAAGAAAAATTATCTATCTATCTATCTATCAAGATAGGGAATAATGGAGAAATAAAGAAAGTGGAAAAAGATCAGATCAGATCTTTGGATTAATGGTGTAATAGTTTGGTGATAAAAGAGGTTAAAAAAGTATTAGAAATAAAAGATAAGGAAATGAATGAATGAGGAAGATTAGATTAATTGAATGTTAAAAGTTAA
|
||||
@@ -0,0 +1 @@
|
||||
GGGGAATATGGTTATTAAGTTAAAGAGAAAGAAAGATGTGGGTGATATTAATGAATGAATGAATGAATGAATGAATGAATGTTATGATAGAAGGATAAAAATTAAATAAAATTTTAGTTAATAGAAAAAGAATATATAGAGATCAGATCTATCTATCTATCTTAAGGAGAGGAAGAGATAAAAAAATATAATTAAGGAA
|
||||
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
File diff suppressed because one or more lines are too long
Reference in New Issue
Block a user