added ws202425 courses

2023_CS50X/python/dna/dna.py

@@ -0,0 +1,58 @@
+import csv
+import sys
+
+
+def main():
+
+    # TODO: Check for command-line usage
+
+    # TODO: Read database file into a variable
+    
+    # TODO: Read DNA sequence file into a variable
+
+    # TODO: Find longest match of each STR in DNA sequence
+
+    # TODO: Check database for matching profiles
+
+    return
+
+
+def longest_match(sequence, subsequence):
+    """Returns length of longest run of subsequence in sequence."""
+
+    # Initialize variables
+    longest_run = 0
+    subsequence_length = len(subsequence)
+    sequence_length = len(sequence)
+
+    # Check each character in sequence for most consecutive runs of subsequence
+    for i in range(sequence_length):
+
+        # Initialize count of consecutive runs
+        count = 0
+
+        # Check for a subsequence match in a "substring" (a subset of characters) within sequence
+        # If a match, move substring to next potential match in sequence
+        # Continue moving substring and checking for matches until out of consecutive matches
+        while True:
+
+            # Adjust substring start and end
+            start = i + count * subsequence_length
+            end = start + subsequence_length
+
+            # If there is a match in the substring
+            if sequence[start:end] == subsequence:
+                count += 1
+            
+            # If there is no match in the substring
+            else:
+                break
+        
+        # Update most consecutive matches found
+        longest_run = max(longest_run, count)
+
+    # After checking for runs at each character in seqeuence, return longest run found
+    return longest_run
+
+
+main()

2023_CS50X/python/dna/sequences/1.txt

@@ -0,0 +1 @@
+AAGGTAAGTTTAGAATATAAAAGGTGAGTTAAATAGAATAGGTTAAAATTAAAGGAGATCAGATCAGATCAGATCTATCTATCTATCTATCTATCAGAAAAGAGTAAATAGTTAAAGAGTAAGATATTGAATTAATGGAAAATATTGTTGGGGAAAGGAGGGATAGAAGG

2023_CS50X/python/dna/sequences/2.txt

@@ -0,0 +1 @@
+CGCAAAGACTTTATTGCGCCCACAGTGGCTTTTGTCTACTGATTCCATAGATAATGACAAATGTTCAAGGGGTTCTGGTACTTAGTCCGATCTCAGTGCGACTCGGGGGCGAACGTCGTGGTTATAAACTCGTCCAGATGCCGGCGCCAAACAAATATGATCCCATTGTGCACCCCCACTGGTCAGAACTCTCGGTGCTTAAGCGATACACGCGTCCGTGAGCATTCAACACCCAACTACTAGTCCGGTAATCTGAATGCACACGTGGCCCGGGTTACCGGGATGCCGAAAGAAAGAAAG

2023_CS50X/python/dna/sequences/3.txt

@@ -0,0 +1 @@
+AGAAAGTGATGAGGGAGATAGTTAGGAAAAGGTTAAATTAAATTAAGAAAAATTATCTATCTATCTATCTATCAAGATAGGGAATAATGGAGAAATAAAGAAAGTGGAAAAAGATCAGATCAGATCTTTGGATTAATGGTGTAATAGTTTGGTGATAAAAGAGGTTAAAAAAGTATTAGAAATAAAAGATAAGGAAATGAATGAATGAGGAAGATTAGATTAATTGAATGTTAAAAGTTAA

2023_CS50X/python/dna/sequences/4.txt

@@ -0,0 +1 @@
+GGGGAATATGGTTATTAAGTTAAAGAGAAAGAAAGATGTGGGTGATATTAATGAATGAATGAATGAATGAATGAATGAATGTTATGATAGAAGGATAAAAATTAAATAAAATTTTAGTTAATAGAAAAAGAATATATAGAGATCAGATCTATCTATCTATCTTAAGGAGAGGAAGAGATAAAAAAATATAATTAAGGAA

2023_CS50X/python/sentimental-cash/cash.py

@@ -0,0 +1,38 @@
+# TODO
+
+quarters = 0.25
+dimes = 0.10
+nickels = 0.05
+pennies = 0.01
+
+coins = 0
+
+print('Change owed: ')
+
+while True:
+    try:
+        change = float(input())
+        if change >= 0:
+            break
+        else:
+            print("Change must be greater then 0: ")
+    except ValueError:
+        print("Change must be a numeric value: ")
+
+while change > 0:
+    if change >= quarters:
+        change -= quarters
+        coins += 1
+    elif change >= dimes:
+        change -= dimes
+        coins += 1
+    elif change >= nickels:
+        change -= nickels
+        coins += 1
+    elif change >= pennies:
+        change -= pennies
+        coins += 1
+
+    change = round(change, 2)
+
+print(coins)

2023_CS50X/python/sentimental-hello/hello.py

@@ -0,0 +1,4 @@
+# TODO
+print('What is your name?')
+name = input()
+print(f'hello, {name}')

2023_CS50X/python/sentimental-mario-less/mario.py

@@ -0,0 +1,14 @@
+# TODO
+print("Height: ")
+while True:
+    try:
+        size = int(input())
+        if 1 <= size <= 8:
+            break
+        else:
+            print("Height between 1 and 8: ")
+    except ValueError:
+        print("Height with numeric value: ")
+
+for i in range(1, size+1):
+    print(((size - i) * ' ') + (i * '#'))

2023_CS50X/python/sentimental-readability/readability.py

@@ -0,0 +1,31 @@
+# TODO
+
+print('Text: ')
+
+text = str(input())
+
+lettercount = 0
+wordcount = 0
+sentencecount = 0
+
+for i in range(len(text)):
+    if (65 <= ord(text[i]) <= 90) or (97 <= ord(text[i]) <= 122):
+        lettercount += 1
+    elif ord(text[i]) == 32:
+        wordcount += 1
+    elif ord(text[i]) in [33, 63, 46]:
+        sentencecount += 1
+    else:
+        continue
+
+wordcount += 1
+L = lettercount / wordcount * 100
+S = sentencecount / wordcount * 100
+index = 0.0588 * L - 0.296 * S - 15.8
+
+if index <= 1:
+    print("Before Grade 1")
+elif index >= 16:
+    print("Grade 16+")
+else:
+    print(f"Grade {round(index)}")

2023_CS50X/python/world-cup/answers.txt

@@ -0,0 +1,19 @@
+Times:
+
+10 simulations: 0m0.021s
+100 simulations: 0m0.027s
+1000 simulations: 0m0.040s
+10000 simulations: 0m0.084s
+100000 simulations: 0m0.728s
+1000000 simulations: 0m6.556s
+
+Questions:
+
+Which predictions, if any, proved incorrect as you increased the number of simulations?:
+
+With a small number of simulations.
+
+Suppose you're charged a fee for each second of compute time your program uses.
+After how many simulations would you call the predictions "good enough"?: TODO
+
+Predictions stabilized over 10000 simulations.

2023_CS50X/python/world-cup/tournament.py

@@ -0,0 +1,69 @@
+# Simulate a sports tournament
+
+import csv
+import sys
+import random
+
+# Number of simluations to run
+N = 1000
+
+
+def main():
+
+    # Ensure correct usage
+    if len(sys.argv) != 2:
+        sys.exit("Usage: python tournament.py FILENAME")
+
+    teams = []
+    counts = {}
+
+    # TODO: Read teams into memory from file
+    with open(sys.argv[1], 'r') as csvfile:
+        reader = csv.DictReader(csvfile)
+        for row in reader:
+            teams.append({'team': row['team'], 'rating': int(row['rating'])})
+            counts[row['team']] = 0
+
+    # TODO: Simulate N tournaments and keep track of win counts
+    for _ in range(N):
+        winner = simulate_tournament(teams.copy())
+        counts[winner] += 1
+
+    # Print each team's chances of winning, according to simulation
+    for team in sorted(counts, key=lambda team: counts[team], reverse=True):
+        print(f"{team}: {counts[team] * 100 / N:.1f}% chance of winning")
+
+
+def simulate_game(team1, team2):
+    """Simulate a game. Return True if team1 wins, False otherwise."""
+    rating1 = team1["rating"]
+    rating2 = team2["rating"]
+    probability = 1 / (1 + 10 ** ((rating2 - rating1) / 600))
+    return random.random() < probability
+
+
+def simulate_round(teams):
+    """Simulate a round. Return a list of winning teams."""
+    winners = []
+
+    # Simulate games for all pairs of teams
+    for i in range(0, len(teams), 2):
+        if simulate_game(teams[i], teams[i + 1]):
+            winners.append(teams[i])
+        else:
+            winners.append(teams[i + 1])
+
+    return winners
+
+
+def simulate_tournament(teams):
+    """Simulate a tournament. Return name of winning team."""
+    # TODO
+
+    while len(teams) > 1:
+        teams = simulate_round(teams)
+    return teams[0]['team']
+
+
+if __name__ == "__main__":
+    main()